Orthologous regulated operons containing PF13385 gene
| Regulog: | AraR - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | Arabinose utilization |
| Effector: | Arabinose |
| Phylum: | Bacteroidetes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacteroides thetaiotaomicron VPI-5482 | ||||
|
Position: -167
Score: 5.71599 Sequence: AAAGTGTAAAAAAGACACTTA
Locus tag: BT0365
Name: PF13385 Funciton: Concanavalin A-like lectin/glucanases superfamily
Locus tag: BT0364
Name: susC_Ara-1 Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides
Locus tag: BT0363
Name: susD_Ara-1 Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
Locus tag: BT0362
Name: susC_Ara-2 Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides
Locus tag: BT0361
Name: susD_Ara-2 Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
Locus tag: BT0360
Name: abn1 Funciton: Arabinan endo-1,5-alpha-L-arabinosidase |
||||
| PF13385-susC_Ara-1-susD_Ara-1-susC_Ara-2-susD_Ara-2-abn1 | -167 | 5.7 | AAAGTGTAAAAAAGACACTTA | BT0365 |