Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing sbp_Ara-4 gene

Properties
Regulog: AraR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Bacteroidetes
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacteroides thetaiotaomicron VPI-5482
Position: -229
Score: 4.93051
Sequence: ATAATGTAAAATCTACACTCA
Locus tag: BT3047
Name: sbp_Ara-4
Funciton: ix-beta-propeller protein, cell surface exposed, putatively involved in arabinan binding
Locus tag: BT3046
Name: susC_Ara-4
Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides
Locus tag: BT3045
Name: susD_Ara-4
Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
Locus tag: BT3044
Name: BT3044
Funciton: Hypothetical protein, presumably involved in arabinan utilization
sbp_Ara-4-susC_Ara-4-susD_Ara-4-BT3044 -229 4.9 ATAATGTAAAATCTACACTCA BT3047
© 2009-2020 RegPrecise