Orthologous regulated operons containing BT3044 gene
| Regulog: | AraR - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | Arabinose utilization |
| Effector: | Arabinose |
| Phylum: | Bacteroidetes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacteroides thetaiotaomicron VPI-5482 | ||||
|
Position: -229
Score: 4.93051 Sequence: ATAATGTAAAATCTACACTCA
Locus tag: BT3047
Name: sbp_Ara-4 Funciton: ix-beta-propeller protein, cell surface exposed, putatively involved in arabinan binding
Locus tag: BT3046
Name: susC_Ara-4 Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides
Locus tag: BT3045
Name: susD_Ara-4 Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
Locus tag: BT3044
Name: BT3044 Funciton: Hypothetical protein, presumably involved in arabinan utilization |
||||
| sbp_Ara-4-susC_Ara-4-susD_Ara-4-BT3044 | -229 | 4.9 | ATAATGTAAAATCTACACTCA | BT3047 |