Orthologous regulated operons containing RSP_0977 gene

Properties
Regulog:	CceR (GapR) - Rhodobacterales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Central carbohydrate metabolism
Effector:	6-phosphogluconate
Phylum:	Proteobacteria/Alpha

Built upon 177 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhodobacter sphaeroides 2.4.1
Position: -189 Score: 5.09658 Sequence: GCATGATTGCGCAAACATGT Locus tag: RSP_0974 Name: sdhC Funciton: Succinate dehydrogenase cytochrome b-556 subunit Locus tag: RSP_0975 Name: sdhD Funciton: succinate dehydrogenase, cytochrome b subunit Locus tag: RSP_0976 Name: sdhA Funciton: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Locus tag: RSP_0977 Name: RSP_0977 Funciton: hypothetical protein Locus tag: RSP_0978 Name: RSP_0978 Funciton: hypothetical protein Locus tag: RSP_0979 Name: sdhB Funciton: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
sdhC-sdhD-sdhA-RSP_0977-RSP_0978-sdhB	-189	5.1	GCATGATTGCGCAAACATGT	RSP_0974

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --