Orthologous regulated operons containing nigC gene
Regulog: | NigR - Streptococcaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Nigerose utilization |
Effector: | Nigerose-6-phosphate |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Streptococcus mutans UA159 | ||||
Position: -102
Score: 5.77868 Sequence: AATATGGAACGTTCCATGTA
Position: -37
Score: 4.73076 Sequence: GAAATTGAACGTTCAATATT
Locus tag: SMU.100
Name: nigB Funciton: Nigerose-specific PTS system, EIIB component
Locus tag: SMU.101
Name: nigC Funciton: Nigerose-specific PTS system, EIIC component
Locus tag: SMU.102
Name: nigD Funciton: Nigerose-specific PTS system, EIID component
Locus tag: SMU.103
Name: nigA Funciton: Nigerose-specific PTS system, EIIA component
Locus tag: SMU.104
Name: nigE Funciton: Cytoplasmic alpha-glucosidase, family 31 of glycosyl hydrolase
Locus tag: SMU.105
Name: nigR Funciton: Nigerose utilization repressor, LacI family |
||||
nigB-nigC-nigD-nigA-nigE-nigR | -102 | 5.8 | AATATGGAACGTTCCATGTA | SMU.100 |
-37 | 4.7 | GAAATTGAACGTTCAATATT |