Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing nigE gene

Properties
Regulog: NigR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Nigerose utilization
Effector: Nigerose-6-phosphate
Phylum: Firmicutes
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptococcus mutans UA159
Position: -102
Score: 5.77868
Sequence: AATATGGAACGTTCCATGTA
Position: -37
Score: 4.73076
Sequence: GAAATTGAACGTTCAATATT
Locus tag: SMU.100
Name: nigB
Funciton: Nigerose-specific PTS system, EIIB component
Locus tag: SMU.101
Name: nigC
Funciton: Nigerose-specific PTS system, EIIC component
Locus tag: SMU.102
Name: nigD
Funciton: Nigerose-specific PTS system, EIID component
Locus tag: SMU.103
Name: nigA
Funciton: Nigerose-specific PTS system, EIIA component
Locus tag: SMU.104
Name: nigE
Funciton: Cytoplasmic alpha-glucosidase, family 31 of glycosyl hydrolase
Locus tag: SMU.105
Name: nigR
Funciton: Nigerose utilization repressor, LacI family
nigB-nigC-nigD-nigA-nigE-nigR -102 5.8 AATATGGAACGTTCCATGTA SMU.100
-37 4.7 GAAATTGAACGTTCAATATT