Orthologous regulated operons containing PF11175 gene
Regulog: | MsmR - Bifidobacteriaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | |
Biological process: | Carbohydrate metabolism |
Effector: | |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bifidobacterium adolescentis ATCC 15703 | ||||
Position: -186
Score: 6.73173 Sequence: TAATCGAAACGTTTCAATGA
Position: -78
Score: 6.04557 Sequence: TCATCGAAACGTTTCAATAC
Locus tag: BAD_1585
Name: msmE Funciton: Multiple sugar ABC transporter, substrate-binding protein
Locus tag: BAD_1586
Name: msmF Funciton: Multiple sugar ABC transporter, permease protein 1
Locus tag: BAD_1587
Name: msmF Funciton: Multiple sugar ABC transporter, permease protein 2
Locus tag: BAD_1588
Name: PF11175 Funciton: Protein of unknown function (DUF2961) |
||||
msmE-msmF-msmF-PF11175 | -186 | 6.7 | TAATCGAAACGTTTCAATGA | BAD_1585 |
-78 | 6 | TCATCGAAACGTTTCAATAC | ||
Bifidobacterium dentium Bd1 | ||||
Position: -242
Score: 6.54939 Sequence: TAATCGAAACGTTTCAACAA
Locus tag: BDP_2164
Name: msmF Funciton: Multiple sugar ABC transporter, permease protein 2
Locus tag: BDP_2163
Name: PF11175 Funciton: Protein of unknown function (DUF2961) |
||||
msmF-PF11175 | -242 | 6.5 | TAATCGAAACGTTTCAACAA | BDP_2164 |
Bifidobacterium longum subsp. infantis ATCC 15697 | ||||
Position: -196
Score: 6.01764 Sequence: TAATCGAAACGATTCGAAAG
Position: -108
Score: 6.10343 Sequence: TCGTCGAAACGTTTCGAAAA
Locus tag: Blon_0043
Name: msmE Funciton: Multiple sugar ABC transporter, substrate-binding protein
Locus tag: Blon_0044
Name: msmF Funciton: Multiple sugar ABC transporter, permease protein 1
Locus tag: Blon_0045
Name: msmF Funciton: Multiple sugar ABC transporter, permease protein 2
Locus tag: Blon_0046
Name: PF11175 Funciton: Protein of unknown function (DUF2961) |
||||
msmE-msmF-msmF-PF11175 | -196 | 6 | TAATCGAAACGATTCGAAAG | Blon_0043 |
-108 | 6.1 | TCGTCGAAACGTTTCGAAAA |