Orthologous regulated operons containing BIFBRE_00644 gene
| Regulog: | BDP_2100 - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium breve DSM 20213 | ||||
|
Position: -22
Score: 6.72955 Sequence: AAAAATAAACGTTTAGGATT
Locus tag: BIFBRE_00641
Name: null Funciton: Transcriptional regulator, LacI family
Locus tag: BIFBRE_00642
Name: null Funciton: ABC-type transport system, substrate-binding component
Locus tag: BIFBRE_00643
Name: null Funciton: ABC-type transport system, ATPase component
Locus tag: BIFBRE_00644
Name: null Funciton: ABC-type transport system, permease component
Locus tag: BIFBRE_00645
Name: null Funciton: hypothetical protein |
||||
| BIFBRE_00641-BIFBRE_00642-BIFBRE_00643-BIFBRE_00644-BIFBRE_00645 | -22 | 6.7 | AAAAATAAACGTTTAGGATT | BIFBRE_00641 |