Orthologous regulated operons containing PF07944 gene
| Regulog: | AraQ - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium adolescentis ATCC 15703 | ||||
|
Position: -49
Score: 5.52218 Sequence: GATTGTGAGCGTTAACAAGA
Locus tag: BAD_1529
Name: PF07944 Funciton: Putative glycosyl hydrolase of unknown function (DUF1680)
Locus tag: BAD_1528
Name: aga Funciton: Alpha-galactosidase (EC 3.2.1.22) |
||||
| PF07944-aga | -49 | 5.5 | GATTGTGAGCGTTAACAAGA | BAD_1529 |