Orthologous regulated operons containing maa gene
| Regulog: | AraQ - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium adolescentis ATCC 15703 | ||||
|
Position: -20
Score: 5.44535 Sequence: TGGTGTGAGCGTTCACTATA
Locus tag: BAD_0431
Name: maa Funciton: Maltose O-acetyltransferase (EC 2.3.1.79) |
||||
| maa | -20 | 5.4 | TGGTGTGAGCGTTCACTATA | BAD_0431 |
| Bifidobacterium dentium Bd1 | ||||
|
Position: -49
Score: 5.51768 Sequence: TTGCGTGAACGCTCACAACA
Locus tag: BDP_0569
Name: maa Funciton: Maltose O-acetyltransferase (EC 2.3.1.79) |
||||
| maa | -49 | 5.5 | TTGCGTGAACGCTCACAACA | BDP_0569 |