Orthologous regulated operons containing Blon_2290 gene
| Regulog: | AraQ - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium breve DSM 20213 | ||||
|
Position: -213
Score: 5.22251 Sequence: CGGTGTGAACGCTCACACGT
Locus tag: BIFBRE_00165
Name: null Funciton: hypothetical protein
Locus tag: BIFBRE_00164
Name: null Funciton: Regulator of polyketide synthase expression |
||||
| BIFBRE_00165-BIFBRE_00164 | -213 | 5.2 | CGGTGTGAACGCTCACACGT | BIFBRE_00165 |
| Bifidobacterium longum NCC2705 | ||||
|
Position: -123
Score: 4.99614 Sequence: CCATGTTAACGTTCACAACT
Locus tag: BL1532
Name: null Funciton: hypothetical protein
Locus tag: BL1531
Name: null Funciton: Regulator of polyketide synthase expression |
||||
| BL1532-BL1531 | -123 | 5 | CCATGTTAACGTTCACAACT | BL1532 |
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||||
|
Position: -144
Score: 4.91561 Sequence: CCGTGTTAACGTTCACAACT
Locus tag: Blon_2289
Name: null Funciton: hypothetical protein
Locus tag: Blon_2290
Name: null Funciton: Regulator of polyketide synthase expression |
||||
| Blon_2289-Blon_2290 | -144 | 4.9 | CCGTGTTAACGTTCACAACT | Blon_2289 |