Orthologous regulated operons containing Blon_1763 gene
| Regulog: | AraQ - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Central carbohydrate metabolism; Arabinose utilization; Arabinose oligosaccharide utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium breve DSM 20213 | ||||
|
Position: -108
Score: 5.42046 Sequence: CAATGAGAGCGCTCACAATC
Locus tag: BIFBRE_01039
Name: glgB Funciton: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
Locus tag: BIFBRE_01038
Name: null Funciton: response regulator of two-component system
Locus tag: BIFBRE_01037
Name: null Funciton: histidine kinase sensor of two-component system |
||||
| glgB-BIFBRE_01038-BIFBRE_01037 | -108 | 5.4 | CAATGAGAGCGCTCACAATC | BIFBRE_01039 |
| Bifidobacterium longum NCC2705 | ||||
|
Position: -147
Score: 5.3485 Sequence: CTATGAGAGCGCTCACAACC
Locus tag: BL0999
Name: glgB Funciton: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
Locus tag: BL1000
Name: null Funciton: response regulator of two-component system
Locus tag: BL1001
Name: null Funciton: histidine kinase sensor of two-component system |
||||
| glgB-BL1000-BL1001 | -147 | 5.3 | CTATGAGAGCGCTCACAACC | BL0999 |
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||||
|
Position: -108
Score: 5.3485 Sequence: CTATGAGAGCGCTCACAACC
Locus tag: Blon_1761
Name: glgB Funciton: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
Locus tag: Blon_1762
Name: null Funciton: response regulator of two-component system
Locus tag: Blon_1763
Name: null Funciton: histidine kinase sensor of two-component system |
||||
| glgB-Blon_1762-Blon_1763 | -108 | 5.3 | CTATGAGAGCGCTCACAACC | Blon_1761 |