Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing gatC gene

Properties
Regulog: SgaR - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: SorC
Regulation mode:
Biological process: L-xylulose utilization
Effector: L-xylulose
Phylum: Actinobacteria
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium bifidum NCIMB 41171
Position: -167
Score: 6.06093
Sequence: CGATGAACATGTGTTCATCG
Locus tag: BbifN4_010100001337
Name: gatC
Funciton: putative L-xylulose permease, PTS system IIC component
Locus tag: BbifN4_010100001342
Name: lyxK
Funciton: L-xylulose kinase (EC 2.7.1.-)
Locus tag: BbifN4_010100001347
Name: sgaU
Funciton: L-xylulose 5-phosphate 3-epimerase (EC 5.1.3.-)
Locus tag: BbifN4_010100001352
Name: sgaE/araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
gatC-lyxK-sgaU-sgaE/araD -167 6.1 CGATGAACATGTGTTCATCG BbifN4_010100001337