Orthologous regulated operons containing sgaE/araD gene
Regulog: | SgaR - Bifidobacteriaceae |
Regulator type: | Transcription factor |
Regulator family: | SorC |
Regulation mode: | |
Biological process: | L-xylulose utilization |
Effector: | L-xylulose |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bifidobacterium bifidum NCIMB 41171 | ||||
Position: -167
Score: 6.06093 Sequence: CGATGAACATGTGTTCATCG
Locus tag: BbifN4_010100001337
Name: gatC Funciton: putative L-xylulose permease, PTS system IIC component
Locus tag: BbifN4_010100001342
Name: lyxK Funciton: L-xylulose kinase (EC 2.7.1.-)
Locus tag: BbifN4_010100001347
Name: sgaU Funciton: L-xylulose 5-phosphate 3-epimerase (EC 5.1.3.-)
Locus tag: BbifN4_010100001352
Name: sgaE/araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
||||
gatC-lyxK-sgaU-sgaE/araD | -167 | 6.1 | CGATGAACATGTGTTCATCG | BbifN4_010100001337 |