Orthologous regulated operons containing gosC gene

Properties
Regulog:	GosR - Bifidobacteriaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Galactooligosaccharide utilization; Galactan utilization
Effector:	Galactobiose
Phylum:	Actinobacteria

Built upon 17 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bifidobacterium dentium Bd1
Position: -216 Score: 5.94546 Sequence: TTGATACAGCTGTGTATCAT Position: -188 Score: 5.8045 Sequence: ATGATACACAGTTGTATCAG Position: -98 Score: 5.97821 Sequence: TTGGTACAGCGGTATATCAA Locus tag: BDP_1911 Name: gosB Funciton: Putative galactooligosaccharide ABC transporter, substrate-binding component Locus tag: BDP_1910 Name: gosC Funciton: Putative galactooligosaccharide ABC transporter, permease component 1 Locus tag: BDP_1909 Name: gosD Funciton: Putative galactooligosaccharide ABC transporter, permease component 2
gosB-gosC-gosD	-216	5.9	TTGATACAGCTGTGTATCAT	BDP_1911
	-188	5.8	ATGATACACAGTTGTATCAG
	-98	6	TTGGTACAGCGGTATATCAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --