Orthologous regulated operons containing gosC gene
| Regulog: | GosR - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Galactooligosaccharide utilization; Galactan utilization |
| Effector: | Galactobiose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium dentium Bd1 | ||||
|
Position: -216
Score: 5.94546 Sequence: TTGATACAGCTGTGTATCAT
Position: -188
Score: 5.8045 Sequence: ATGATACACAGTTGTATCAG
Position: -98
Score: 5.97821 Sequence: TTGGTACAGCGGTATATCAA
Locus tag: BDP_1911
Name: gosB Funciton: Putative galactooligosaccharide ABC transporter, substrate-binding component
Locus tag: BDP_1910
Name: gosC Funciton: Putative galactooligosaccharide ABC transporter, permease component 1
Locus tag: BDP_1909
Name: gosD Funciton: Putative galactooligosaccharide ABC transporter, permease component 2 |
||||
| gosB-gosC-gosD | -216 | 5.9 | TTGATACAGCTGTGTATCAT | BDP_1911 |
| -188 | 5.8 | ATGATACACAGTTGTATCAG | ||
| -98 | 6 | TTGGTACAGCGGTATATCAA | ||