Orthologous regulated operons containing bgaB2 gene
| Regulog: | GosR - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Galactooligosaccharide utilization; Galactan utilization |
| Effector: | Galactobiose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium adolescentis ATCC 15703 | ||||
|
Position: -190
Score: 4.85253 Sequence: ATGGTACACCGGAAAACCTA
Position: -159
Score: 5.27321 Sequence: CAGGTACACAGTTATACCAA
Locus tag: BAD_1405
Name: gosB2 Funciton: Putative galactooligosaccharide ABC transporter, sugar-binding protein
Locus tag: BAD_1404
Name: gosC2 Funciton: Putative galactooligosaccharide ABC transporter, permease protein 1
Locus tag: BAD_1403
Name: gosD2 Funciton: Putative galactooligosaccharide ABC transporter, permease protein 2
Locus tag: BAD_1402
Name: bgaB2 Funciton: Beta-galactosidase (EC 3.2.1.23) |
||||
| gosB2-gosC2-gosD2-bgaB2 | -190 | 4.9 | ATGGTACACCGGAAAACCTA | BAD_1405 |
| -159 | 5.3 | CAGGTACACAGTTATACCAA | ||