Orthologous regulated operons containing gosD2 gene

Properties
Regulog:	GosR - Bifidobacteriaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Galactooligosaccharide utilization; Galactan utilization
Effector:	Galactobiose
Phylum:	Actinobacteria

Built upon 17 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bifidobacterium adolescentis ATCC 15703
Position: -190 Score: 4.85253 Sequence: ATGGTACACCGGAAAACCTA Position: -159 Score: 5.27321 Sequence: CAGGTACACAGTTATACCAA Locus tag: BAD_1405 Name: gosB2 Funciton: Putative galactooligosaccharide ABC transporter, sugar-binding protein Locus tag: BAD_1404 Name: gosC2 Funciton: Putative galactooligosaccharide ABC transporter, permease protein 1 Locus tag: BAD_1403 Name: gosD2 Funciton: Putative galactooligosaccharide ABC transporter, permease protein 2 Locus tag: BAD_1402 Name: bgaB2 Funciton: Beta-galactosidase (EC 3.2.1.23)
gosB2-gosC2-gosD2-bgaB2	-190	4.9	ATGGTACACCGGAAAACCTA	BAD_1405
	-159	5.3	CAGGTACACAGTTATACCAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --