Orthologous regulated operons containing BbifN4_010100001417 gene
| Regulog: | GosR - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Galactooligosaccharide utilization; Galactan utilization |
| Effector: | Galactobiose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium bifidum NCIMB 41171 | ||||
|
Position: -39
Score: 4.88967 Sequence: CTGGTATAGCGGTGCATCAT
Position: -11
Score: 6.09143 Sequence: TTGATACTCCGTTGTATCAA
Locus tag: BbifN4_010100001412
Name: null Funciton: hypothetical protein
Locus tag: BbifN4_010100001417
Name: null Funciton: hypothetical protein
Locus tag: BbifN4_010100001422
Name: PF00248 Funciton: Aldo/keto reductase |
||||
| BbifN4_010100001412-BbifN4_010100001417-PF00248 | -39 | 4.9 | CTGGTATAGCGGTGCATCAT | BbifN4_010100001412 |
| -11 | 6.1 | TTGATACTCCGTTGTATCAA | ||