Orthologous regulated operons containing uxuA gene
Regulog: | RspR - Oceanospirillales/Alteromonadales |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | L-gulonate utilization |
Effector: | L-gulonate; D-mannonate |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Chromohalobacter salexigens DSM 3043 | ||||
Position: -46
Score: 6.20975 Sequence: CCAACTACCATACTAGTCAG
Locus tag: Csal_2973
Name: rspR Funciton: Transcriptional regulator for L-gulonate utilization, GntR family
Locus tag: Csal_2974
Name: rspA Funciton: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
Locus tag: Csal_2975
Name: rspB Funciton: L-gulonate dehydrogenase, COG1063 family
Locus tag: Csal_2976
Name: rspP Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component
Locus tag: Csal_2977
Name: rspQ Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component
Locus tag: Csal_2978
Name: rspM Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component
Locus tag: Csal_2979
Name: rspD Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
Locus tag: Csal_2980
Name: uxuA Funciton: Mannonate dehydratase (EC 4.2.1.8) |
||||
rspR-rspA-rspB-rspP-rspQ-rspM-rspD-uxuA | -46 | 6.2 | CCAACTACCATACTAGTCAG | Csal_2973 |