Orthologous regulated operons containing rspP gene

Properties
Regulog:	RspR - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	L-gulonate utilization
Effector:	L-gulonate; D-mannonate
Phylum:	Proteobacteria/Gamma

Built upon 1 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Chromohalobacter salexigens DSM 3043
Position: -46 Score: 6.20975 Sequence: CCAACTACCATACTAGTCAG Locus tag: Csal_2973 Name: rspR Funciton: Transcriptional regulator for L-gulonate utilization, GntR family Locus tag: Csal_2974 Name: rspA Funciton: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family Locus tag: Csal_2975 Name: rspB Funciton: L-gulonate dehydrogenase, COG1063 family Locus tag: Csal_2976 Name: rspP Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component Locus tag: Csal_2977 Name: rspQ Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component Locus tag: Csal_2978 Name: rspM Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component Locus tag: Csal_2979 Name: rspD Funciton: D-mannonate oxidoreductase (EC 1.1.1.57) Locus tag: Csal_2980 Name: uxuA Funciton: Mannonate dehydratase (EC 4.2.1.8)
rspR-rspA-rspB-rspP-rspQ-rspM-rspD-uxuA	-46	6.2	CCAACTACCATACTAGTCAG	Csal_2973

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --