Orthologous regulated operons containing wrbA gene
| Regulog: | SoxR - Various betaproteobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chromobacterium violaceum ATCC 12472 | ||||
|
Position: -58
Score: 5.22461 Sequence: ACTTCAAGTTAACTTGAACT
Locus tag: CV2794
Name: wrbA Funciton: Multimeric flavodoxin
Locus tag: CV2795
Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase |
||||
| wrbA-PF00903 | -58 | 5.2 | ACTTCAAGTTAACTTGAACT | CV2794 |