Orthologous regulated operons containing PF07690 gene

Properties
Regulog:	SoxR - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Phylum:	Proteobacteria/gamma

Built upon 3 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Moritella sp. PE36
Position: -141 Score: 6.42356 Sequence: ACCTCAACATAACTTGAGGT Locus tag: PE36_09311 Name: PF07690 Funciton: Permease of the major facilitator superfamily
PF07690	-141	6.4	ACCTCAACATAACTTGAGGT	PE36_09311

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --