Orthologous regulated operons containing copZ gene
| Regulog: | CueR - Xanthomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Stenotrophomonas maltophilia K279a | ||||
|
Position: -61
Score: 5.62417 Sequence: ACCCTGCCATCGTTGGAAGGT
Locus tag: Smlt2178
Name: copZ Funciton: Copper chaperone |
||||
| copZ | -61 | 5.6 | ACCCTGCCATCGTTGGAAGGT | Smlt2178 |