Orthologous regulated operons containing cueR gene
| Regulog: | CueR - Xanthomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Stenotrophomonas maltophilia K279a | ||||
|
Position: -62
Score: 6.09972 Sequence: ACCTTCCCACGATGGCAAGGT
Locus tag: Smlt2176
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Smlt2177
Name: cueR Funciton: Copper resistance ranscriptional regulator, MerR family |
||||
| copA-cueR | -62 | 6.1 | ACCTTCCCACGATGGCAAGGT | Smlt2176 |