Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing copA gene

Properties
Regulog: CueR - Xanthomonadales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/gamma
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Stenotrophomonas maltophilia K279a
Position: -62
Score: 6.09972
Sequence: ACCTTCCCACGATGGCAAGGT
Locus tag: Smlt2176
Name: copA
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Smlt2177
Name: cueR
Funciton: Copper resistance ranscriptional regulator, MerR family
copA-cueR -62 6.1 ACCTTCCCACGATGGCAAGGT Smlt2176
© 2009-2020 RegPrecise