Orthologous regulated operons containing COG1120 gene

Properties
Regulog:	IdeR - Clostridia-3
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Firmicutes

Built upon 78 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Clostridium nexile DSM 1787
Position: -63 Score: 5.07371 Sequence: CTGGTTAGTTTAATCTAACAAA Locus tag: CLONEX_02589 Name: PF05031 Funciton: Iron transport-associated domain Locus tag: CLONEX_02590 Name: PF11545 Funciton: Cell surface heme-binding protein Shp Locus tag: CLONEX_02591 Name: COG0614 Funciton: ABC-type Fe3+-hydroxamate transport system, periplasmic component Locus tag: CLONEX_02592 Name: COG0609 Funciton: ABC-type Fe3+-siderophore transport system, permease component Locus tag: CLONEX_02593 Name: COG1120 Funciton: ABC-type Fe3+-siderophores transport systems, ATPase components
PF05031-PF11545-COG0614-COG0609-COG1120	-63	5.1	CTGGTTAGTTTAATCTAACAAA	CLONEX_02589
Ruminococcus gnavus ATCC 29149
Position: -135 Score: 4.29404 Sequence: AACGATAAAGTGTACTATCTTA Position: -130 Score: 4.33286 Sequence: ATAAGTAGAATCTTCTAAAACA Position: -93 Score: 5.68954 Sequence: ATGATTAGAATAAACTAATAAA Position: -36 Score: 5.37837 Sequence: ATAGTTAGCGAAAACTAACTTG Locus tag: RUMGNA_02766 Name: null Funciton: hypothetical protein Locus tag: RUMGNA_02767 Name: null Funciton: hypothetical protein Locus tag: RUMGNA_02768 Name: PF05031 Funciton: Iron transport-associated domain Locus tag: RUMGNA_02769 Name: PF11545 Funciton: Cell surface heme-binding protein Shp Locus tag: RUMGNA_02770 Name: COG0614 Funciton: ABC-type Fe3+-hydroxamate transport system, periplasmic component Locus tag: RUMGNA_02771 Name: COG0609 Funciton: ABC-type Fe3+-siderophore transport system, permease component Locus tag: RUMGNA_02772 Name: COG1120 Funciton: ABC-type Fe3+-siderophores transport systems, ATPase components
RUMGNA_02766-RUMGNA_02767-PF05031-PF11545-COG0614-COG0609-COG1120	-135	4.3	AACGATAAAGTGTACTATCTTA	RUMGNA_02766
	-130	4.3	ATAAGTAGAATCTTCTAAAACA
	-93	5.7	ATGATTAGAATAAACTAATAAA
	-36	5.4	ATAGTTAGCGAAAACTAACTTG