Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing BRYFOR_03561 gene

Properties
Regulog: IdeR - Clostridia-3
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Firmicutes
Built upon 78 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bryantella formatexigens DSM 14469
Position: -82
Score: 6.22724
Sequence: AATGTTAGCATATACTAACTTC
Locus tag: BRYFOR_03558
Name: null
Funciton: hypothetical protein
Locus tag: BRYFOR_03559
Name: feoA
Funciton: Ferrous iron transport protein A
Locus tag: BRYFOR_03560
Name: feoB
Funciton: Ferrous iron transport protein B
Locus tag: BRYFOR_03561
Name: null
Funciton: hypothetical protein
Locus tag: BRYFOR_03562
Name: null
Funciton: hypothetical protein
BRYFOR_03558-feoA-feoB-BRYFOR_03561-BRYFOR_03562 -82 6.2 AATGTTAGCATATACTAACTTC BRYFOR_03558
Dorea longicatena DSM 13814
Position: -120
Score: 6.73931
Sequence: AACGTTAGCATATACTAACTAT
Locus tag: DORLON_00346
Name: null
Funciton: hypothetical protein
Locus tag: DORLON_00347
Name: feoA
Funciton: Ferrous iron transport protein A
Locus tag: DORLON_00348
Name: feoB
Funciton: Ferrous iron transport protein B
Locus tag: DORLON_00349
Name: null
Funciton: hypothetical protein
Locus tag: DORLON_00350
Name: null
Funciton: hypothetical protein
Locus tag: DORLON_00351
Name: null
Funciton: hypothetical protein
Locus tag: DORLON_00352
Name: null
Funciton: hypothetical protein
Locus tag: DORLON_00353
Name: null
Funciton: hypothetical protein
Locus tag: DORLON_00354
Name: COG2217
Funciton: Cation transporting ATPase
DORLON_00346-feoA-feoB-DORLON_00349-DORLON_00350-DORLON_00351-DORLON_00352-DORLON_00353-COG2217 -120 6.7 AACGTTAGCATATACTAACTAT DORLON_00346
Ruminococcus lactaris ATCC 29176
Position: -132
Score: 5.99532
Sequence: CACGTTAGCGTATACTAACTAA
Locus tag: RUMLAC_01079
Name: null
Funciton: hypothetical protein
Locus tag: RUMLAC_01080
Name: feoA
Funciton: Ferrous iron transport protein A
Locus tag: RUMLAC_01081
Name: feoB
Funciton: Ferrous iron transport protein B
Locus tag: RUMLAC_01082
Name: null
Funciton: hypothetical protein
Locus tag: RUMLAC_01083
Name: null
Funciton: hypothetical protein
Locus tag: RUMLAC_01084
Name: null
Funciton: hypothetical protein
Locus tag: RUMLAC_01085
Name: fur
Funciton: Transcriptional regulator for iron transport and metabolism, Fur family
Locus tag: RUMLAC_01086
Name: null
Funciton: hypothetical protein
Locus tag: RUMLAC_01087
Name: COG2217
Funciton: Cation transporting ATPase
RUMLAC_01079-feoA-feoB-RUMLAC_01082-RUMLAC_01083-RUMLAC_01084-fur-RUMLAC_01086-COG2217 -132 6 CACGTTAGCGTATACTAACTAA RUMLAC_01079