Orthologous regulated operons containing ccoG gene
| Regulog: | FnrN - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator (repressor) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Jannaschia sp. CCS1 | ||||
|
Position: -84
Score: 5.43887 Sequence: AACTTGATCCACGTCAAAGC
Locus tag: Jann_3853
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: Jann_3852
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: Jann_3851
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Jann_3850
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoG-ccoH-ccoI-ccoS | -84 | 5.4 | AACTTGATCCACGTCAAAGC | Jann_3853 |
| Loktanella vestfoldensis SKA53 | ||||
|
Position: -177
Score: 5.56421 Sequence: TGCTTGATCCACATCAAGGA
Locus tag: SKA53_08641
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: SKA53_08646
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: SKA53_08651
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: SKA53_08656
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoG-ccoH-ccoI-ccoS | -177 | 5.6 | TGCTTGATCCACATCAAGGA | SKA53_08641 |
| Oceanicola batsensis HTCC2597 | ||||
|
Position: -77
Score: 5.70955 Sequence: GCCTTGATGCAGATCAAAGG
Locus tag: OB2597_20591
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: OB2597_20596
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: OB2597_20601
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: OB2597_20606
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoG-ccoH-ccoI-ccoS | -77 | 5.7 | GCCTTGATGCAGATCAAAGG | OB2597_20591 |
| Paracoccus denitrificans PD1222 | ||||
|
Position: -70
Score: 5.26945 Sequence: CGCTTGACGCAGATCAATGC
Locus tag: Pden_1844
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: Pden_1843
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: Pden_1842
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Pden_1841
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoG-ccoH-ccoI-ccoS | -70 | 5.3 | CGCTTGACGCAGATCAATGC | Pden_1844 |
| Rhodobacter sphaeroides 2.4.1 | ||||
|
Position: -136
Score: 5.11642 Sequence: TCCTTGATGAGGATCAAGTA
Position: -104
Score: 5.38772 Sequence: CCATTGACATGGATCAAGGC
Locus tag: RSP_0696
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: RSP_0695
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: RSP_0694
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: RSP_0693
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: RSP_0692
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: RSP_0691
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: RSP_0690
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: RSP_0689
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS | -136 | 5.1 | TCCTTGATGAGGATCAAGTA | RSP_0696 |
| -104 | 5.4 | CCATTGACATGGATCAAGGC | ||
| Rhodobacterales bacterium HTCC2654 | ||||
|
Position: 0
Score: 5.17218 Sequence: ATGTTGATCCAAGTCAAGGC
Locus tag: RB2654_10004
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: RB2654_09999
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: RB2654_09994
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: RB2654_09989
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoG-ccoH-ccoI-ccoS | 0 | 5.2 | ATGTTGATCCAAGTCAAGGC | RB2654_10004 |
| Roseobacter sp. MED193 | ||||
|
Position: -180
Score: 5.42996 Sequence: TTTTTGATCCACGTCAAAGA
Locus tag: MED193_11193
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: MED193_11188
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: MED193_11183
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: MED193_11178
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoG-ccoH-ccoI-ccoS | -180 | 5.4 | TTTTTGATCCACGTCAAAGA | MED193_11193 |
| Roseovarius sp. 217 | ||||
|
Position: -73
Score: 5.45265 Sequence: AATTTGATGCAGGTCAAAGC
Locus tag: ROS217_12261
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: ROS217_12266
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: ROS217_12271
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: ROS217_12276
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoG-ccoH-ccoI-ccoS | -73 | 5.5 | AATTTGATGCAGGTCAAAGC | ROS217_12261 |
| Silicibacter TM1040 | ||||
|
Position: -79
Score: 5.42274 Sequence: TTTTTGATCCACGTCAAAGT
Locus tag: TM1040_2540
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: TM1040_2539
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: TM1040_2538
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: TM1040_2537
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoG-ccoH-ccoI-ccoS | -79 | 5.4 | TTTTTGATCCACGTCAAAGT | TM1040_2540 |
| Silicibacter pomeroyi DSS-3 | ||||
|
Position: -80
Score: 5.4002 Sequence: TTTTTGACCCATATCAAAGT
Locus tag: SPO3522
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: SPO3521
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: SPO3520
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: SPO3519
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoG-ccoH-ccoI-ccoS | -80 | 5.4 | TTTTTGACCCATATCAAAGT | SPO3522 |
| Sulfitobacter sp. EE-36 | ||||
|
Position: -74
Score: 5.63715 Sequence: TGTTTGATGCAGATCAAAGC
Locus tag: EE36_02218
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: EE36_02213
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: EE36_02208
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: EE36_02203
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoG-ccoH-ccoI-ccoS | -74 | 5.6 | TGTTTGATGCAGATCAAAGC | EE36_02218 |