Orthologous regulated operons containing ccoX gene

Properties
Regulog:	FnrN - Sphingomonadales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/alpha

Built upon 23 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Sphingomonas wittichii RW1
Position: -200 Score: 5.13916 Sequence: GATTTGATCTGGCGCAAGGC Locus tag: Swit_1801 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: Swit_1800 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: Swit_1799 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: Swit_1798 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: Swit_1797 Name: ccoX Funciton: Predicted integral membrane protein CcoX Locus tag: Swit_1796 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Swit_1795 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN-ccoO-ccoQ-ccoP-ccoX-ccoI-ccoS	-200	5.1	GATTTGATCTGGCGCAAGGC	Swit_1801

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --