Orthologous regulated operons containing ccoS gene
| Regulog: | FnrN - Sphingomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator (repressor) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Erythrobacter sp. NAP1 | ||||
|
Position: -72
Score: 4.55505 Sequence: AACTTGATCTGAGTCAAACA
Locus tag: NAP1_15803
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: NAP1_15808
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: NAP1_15813
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: NAP1_15818
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: NAP1_15823
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: NAP1_15828
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: NAP1_15833
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: NAP1_15838
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS | -72 | 4.6 | AACTTGATCTGAGTCAAACA | NAP1_15803 |
| Novosphingobium aromaticivorans DSM 12444 | ||||
|
Position: -144
Score: 4.63311 Sequence: ACATTGACGGAGCGCAAAAA
Position: -77
Score: 4.9263 Sequence: TATTTGACAAGGGTCAATGT
Locus tag: Saro_2578
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: Saro_2577
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: Saro_2576
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: Saro_2575
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: Saro_2574
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: Saro_2573
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: Saro_2572
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Saro_2571
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS | -144 | 4.6 | ACATTGACGGAGCGCAAAAA | Saro_2578 |
| -77 | 4.9 | TATTTGACAAGGGTCAATGT | ||
| Sphingobium japonicum UT26S | ||||
|
Position: -74
Score: 5.54064 Sequence: GCTTTGACAGAGGTCAATGC
Locus tag: SJA_C2-00670
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: SJA_C2-00680
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: SJA_C2-00690
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: SJA_C2-00700
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: SJA_C2-00710
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: SJA_C2-00720
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: SJA_C2-00730
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: SJA_C2-00740
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS | -74 | 5.5 | GCTTTGACAGAGGTCAATGC | SJA_C2-00670 |
| Sphingomonas wittichii RW1 | ||||
|
Position: -200
Score: 5.13916 Sequence: GATTTGATCTGGCGCAAGGC
Locus tag: Swit_1801
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: Swit_1800
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: Swit_1799
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: Swit_1798
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: Swit_1797
Name: ccoX Funciton: Predicted integral membrane protein CcoX
Locus tag: Swit_1796
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Swit_1795
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoN-ccoO-ccoQ-ccoP-ccoX-ccoI-ccoS | -200 | 5.1 | GATTTGATCTGGCGCAAGGC | Swit_1801 |
| Sphingopyxis alaskensis RB2256 | ||||
|
Position: -112
Score: 4.61486 Sequence: GCATTGATGGAGCGCAAGCA
Position: -90
Score: 5.28227 Sequence: TCGTTGATCCCGGTCAATGT
Locus tag: Sala_1676
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: Sala_1675
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: Sala_1674
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: Sala_1673
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: Sala_1672
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: Sala_1671
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: Sala_1670
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Sala_1669
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS | -112 | 4.6 | GCATTGATGGAGCGCAAGCA | Sala_1676 |
| -90 | 5.3 | TCGTTGATCCCGGTCAATGT | ||