Orthologous regulated operons containing NT01CX_0298 gene

Properties
Regulog:	AgaR - Clostridia-1
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	N-acetylgalactosamine utilization
Effector:
Phylum:	Firmicutes

Built upon 19 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Clostridium novyi NT
Position: -317 Score: 5.78865 Sequence: AATGTGGTAATAACAACATT Position: -235 Score: 5.27539 Sequence: GAACTGGTAATGACAACATT Locus tag: NT01CX_0299 Name: NT01CX_0299 Funciton: Predicted N-acetylgalactosamine permease Locus tag: NT01CX_0298 Name: null Funciton: conserved hypothetical protein Locus tag: NT01CX_0297 Name: NT01CX_0297 Funciton: N-acetylgalactosamine 6-sulfate sulfatase Locus tag: NT01CX_0296 Name: agaK2 Funciton: Predicted N-acetylgalactosamine kinase (EC 2.7.1.157)
NT01CX_0299-NT01CX_0298-NT01CX_0297-agaK2	-317	5.8	AATGTGGTAATAACAACATT	NT01CX_0299
	-235	5.3	GAACTGGTAATGACAACATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --