Orthologous regulated operons containing agaK2 gene
| Regulog: | AgaR - Clostridia-1 |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | N-acetylgalactosamine utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Clostridium novyi NT | ||||
|
Position: -317
Score: 5.78865 Sequence: AATGTGGTAATAACAACATT
Position: -235
Score: 5.27539 Sequence: GAACTGGTAATGACAACATT
Locus tag: NT01CX_0299
Name: NT01CX_0299 Funciton: Predicted N-acetylgalactosamine permease
Locus tag: NT01CX_0298
Name: null Funciton: conserved hypothetical protein
Locus tag: NT01CX_0297
Name: NT01CX_0297 Funciton: N-acetylgalactosamine 6-sulfate sulfatase
Locus tag: NT01CX_0296
Name: agaK2 Funciton: Predicted N-acetylgalactosamine kinase (EC 2.7.1.157) |
||||
| NT01CX_0299-NT01CX_0298-NT01CX_0297-agaK2 | -317 | 5.8 | AATGTGGTAATAACAACATT | NT01CX_0299 |
| -235 | 5.3 | GAACTGGTAATGACAACATT | ||
| Clostridium perfringens ATCC 13124 | ||||
|
Position: -40
Score: 5.78808 Sequence: CAAGTGGTAATTACAACTAT
Locus tag: CPF_2149
Name: agaK2 Funciton: Predicted N-acetylgalactosamine kinase (EC 2.7.1.157) |
||||
| agaK2 | -40 | 5.8 | CAAGTGGTAATTACAACTAT | CPF_2149 |