Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Rmet_2487 gene

Properties
Regulog: SdhR - Ralstonia
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Tricarboxylic acid cycle
Effector:
Phylum: Proteobacteria/Beta
Built upon 41 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Ralstonia metallidurans CH34
Position: -78
Score: 7.89101
Sequence: TCATATGTCTTATATAAGACATAAGA
Locus tag: Rmet_2488
Name: sdhR
Funciton: Transcriptional regulator of TCA cycle, GntR family
Locus tag: Rmet_2487
Name: null
Funciton: hypothetical protein
Locus tag: Rmet_2486
Name: sdhC
Funciton: Succinate dehydrogenase cytochrome b-556 subunit
Locus tag: Rmet_2485
Name: sdhD
Funciton: Succinate dehydrogenase hydrophobic membrane anchor protein
Locus tag: Rmet_2484
Name: sdhA
Funciton: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
Locus tag: Rmet_2483
Name: sdhB
Funciton: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
Locus tag: Rmet_2482
Name: COG2938
Funciton: succinate dehydrogenase iron-sulfur subunit
Locus tag: Rmet_2481
Name: gltA
Funciton: Citrate synthase (si) (EC 2.3.3.1)
sdhR-Rmet_2487-sdhC-sdhD-sdhA-sdhB-COG2938-gltA -78 7.9 TCATATGTCTTATATAAGACATAAGA Rmet_2488
© 2009-2020 RegPrecise