Orthologous regulated operons containing drlK gene
Regulog: | RbsR - Thermotogales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Ribose utilization |
Effector: | Ribose |
Phylum: | Thermotogae |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Thermotoga lettingae TMO | ||||
Position: -59
Score: 6.5232 Sequence: TCTTGAAAACGTTTTCAAGA
Position: -47
Score: 5.77485 Sequence: TTTCAAGAACGTTTTCAAAA
Locus tag: Tlet_1324
Name: rbsR Funciton: Predicted regulator of ribose utilization, LacI family
Locus tag: Tlet_1325
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: Tlet_1326
Name: TM0957 Funciton: hypothetical protein
Locus tag: Tlet_1327
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: Tlet_1328
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: Tlet_1329
Name: tktA Funciton: transketolase, N-terminal subunit
Locus tag: Tlet_1330
Name: tktB Funciton: transketolase, C-terminal subunit
Locus tag: Tlet_1331
Name: drlK Funciton: Predicted D-ribulose kinase, FGGY family
Locus tag: Tlet_1332
Name: darA Funciton: Predicted D-arabinose isomerase |
||||
rbsR-rbsB-TM0957-rbsA-rbsC-tktA-tktB-drlK-darA | -59 | 6.5 | TCTTGAAAACGTTTTCAAGA | Tlet_1324 |
-47 | 5.8 | TTTCAAGAACGTTTTCAAAA | ||
Thermotoga maritima MSB8 | ||||
Position: -46
Score: 6.50488 Sequence: TTGTGAAAACGATTTCGAAA
Position: -34
Score: 5.88371 Sequence: TTTCGAAAACGATTTCATCA
Locus tag: TM0960
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: TM0959
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: TM0958
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: TM0957
Name: TM0957 Funciton: hypothetical protein
Locus tag: TM0956
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: TM0955
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: TM0954
Name: tktA Funciton: transketolase, N-terminal subunit
Locus tag: TM0953
Name: tktB Funciton: transketolase, C-terminal subunit
Locus tag: TM0952
Name: drlK Funciton: Predicted D-ribulose kinase, FGGY family
Locus tag: TM0951
Name: darA Funciton: Predicted D-arabinose isomerase
Locus tag: TM0950
Name: TM0950 Funciton: hypothetical protein
Locus tag: TM0949
Name: rbsR Funciton: Predicted regulator of ribose utilization, LacI family |
||||
rbsK-rbsD-rbsB-TM0957-rbsA-rbsC-tktA-tktB-drlK-darA-TM0950-rbsR | -46 | 6.5 | TTGTGAAAACGATTTCGAAA | TM0960 |
-34 | 5.9 | TTTCGAAAACGATTTCATCA | ||
Thermotoga neapolitana DSM 4359 | ||||
Position: 32
Score: 6.50488 Sequence: TTGTGAAAACGATTTCGAAA
Position: 44
Score: 5.88371 Sequence: TTTCGAAAACGATTTCATCA
Locus tag: CTN_1616
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: CTN_1617
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: CTN_1618
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: CTN_1619
Name: TM0957 Funciton: hypothetical protein
Locus tag: CTN_1620
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: CTN_1621
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: CTN_1622
Name: tktA Funciton: transketolase, N-terminal subunit
Locus tag: CTN_1623
Name: tktB Funciton: transketolase, C-terminal subunit
Locus tag: CTN_1624
Name: drlK Funciton: Predicted D-ribulose kinase, FGGY family
Locus tag: CTN_1625
Name: darA Funciton: Predicted D-arabinose isomerase
Locus tag: CTN_1626
Name: TM0950 Funciton: hypothetical protein
Locus tag: CTN_1627
Name: rbsR Funciton: Predicted regulator of ribose utilization, LacI family |
||||
rbsK-rbsD-rbsB-TM0957-rbsA-rbsC-tktA-tktB-drlK-darA-TM0950-rbsR | 32 | 6.5 | TTGTGAAAACGATTTCGAAA | CTN_1616 |
44 | 5.9 | TTTCGAAAACGATTTCATCA |