Orthologous regulated operons containing tsrE gene
Regulog: | TsrR - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | [Other] |
Regulation mode: | |
Biological process: | Thiosulfate reduction |
Effector: | Thiosulfate |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Shewanella halifaxensis HAW-EB4 | ||||
Position: -287
Score: 4.73586 Sequence: CTTTTTTGCGATTCAAAAAACG
Position: -257
Score: 6.03197 Sequence: TGATTTTTATATCTAAAAAGAT
Locus tag: Shal_0567
Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Shal_0568
Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Shal_0569
Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Shal_0570
Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Shal_0571
Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: Shal_0572
Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: Shal_0573
Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: Shal_0574
Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: Shal_0575
Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: Shal_0576
Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: Shal_0577
Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain |
||||
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR | -287 | 4.7 | CTTTTTTGCGATTCAAAAAACG | Shal_0567 |
-257 | 6 | TGATTTTTATATCTAAAAAGAT | ||
Shewanella loihica PV-4 | ||||
Position: -320
Score: 5.37216 Sequence: TATTTTTCATAACTCAAAAAGC
Position: -290
Score: 6.20201 Sequence: CTTTTTTGAGATCTAAAAATGC
Locus tag: Shew_0348
Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Shew_0349
Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Shew_0350
Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Shew_0351
Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Shew_0352
Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: Shew_0353
Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: Shew_0354
Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: Shew_0355
Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: Shew_0356
Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: Shew_0357
Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: Shew_0358
Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain |
||||
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR | -320 | 5.4 | TATTTTTCATAACTCAAAAAGC | Shew_0348 |
-290 | 6.2 | CTTTTTTGAGATCTAAAAATGC | ||
Shewanella oneidensis MR-1 | ||||
Position: -250
Score: 6.87076 Sequence: GTTTTTTTAGATCTAAAAAAAC
Locus tag: SO0479
Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: SO0480
Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: SO0481
Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: SO0482
Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: SO0483
Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: SO0484
Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: SO0485
Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: SO0486
Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: SO0487
Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: SO0488
Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: SO0490
Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain |
||||
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR | -250 | 6.9 | GTTTTTTTAGATCTAAAAAAAC | SO0479 |
Shewanella pealeana ATCC 700345 | ||||
Position: -264
Score: 6.31096 Sequence: GTCTTTTTAGATATCAAAAAAT
Position: -262
Score: 4.79101 Sequence: CTTTTTAGATATCAAAAAATGC
Locus tag: Spea_0479
Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Spea_0480
Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Spea_0481
Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Spea_0482
Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Spea_0483
Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: Spea_0484
Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: Spea_0485
Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: Spea_0486
Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: Spea_0487
Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: Spea_0488
Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: Spea_0489
Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain |
||||
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR | -264 | 6.3 | GTCTTTTTAGATATCAAAAAAT | Spea_0479 |
-262 | 4.8 | CTTTTTAGATATCAAAAAATGC | ||
Shewanella piezotolerans WP3 | ||||
Position: -366
Score: 6.4489 Sequence: CTTTTTTTAGATCTAAAAATAA
Locus tag: swp_4657
Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: swp_4656
Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: swp_4655
Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: swp_4654
Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: swp_4653
Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: swp_4652
Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: swp_4651
Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: swp_4649
Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: swp_4648
Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: swp_4647
Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: swp_4644
Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain |
||||
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR | -366 | 6.4 | CTTTTTTTAGATCTAAAAATAA | swp_4657 |
Shewanella sediminis HAW-EB3 | ||||
Position: -254
Score: 6.12805 Sequence: ATCCTTTTAGATCTAAAAAACA
Locus tag: Ssed_0482
Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Ssed_0483
Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Ssed_0484
Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Ssed_0485
Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Ssed_0486
Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: Ssed_0487
Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: Ssed_0488
Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: Ssed_0489
Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: Ssed_0490
Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: Ssed_0491
Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: Ssed_0492
Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain |
||||
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR | -254 | 6.1 | ATCCTTTTAGATCTAAAAAACA | Ssed_0482 |
Shewanella sp ANA-3 | ||||
Position: -253
Score: 6.44135 Sequence: CTCTTTTTAGATCTAAAAAGCC
Locus tag: Shewana3_0489
Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Shewana3_0490
Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Shewana3_0491
Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Shewana3_0492
Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Shewana3_0493
Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: Shewana3_0494
Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF |
||||
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF | -253 | 6.4 | CTCTTTTTAGATCTAAAAAGCC | Shewana3_0489 |
Shewanella sp MR-4 | ||||
Position: -253
Score: 6.4162 Sequence: GTCTTTTTATATCTCAAAAAAC
Locus tag: Shewmr4_0488
Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Shewmr4_0489
Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Shewmr4_0490
Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Shewmr4_0491
Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Shewmr4_0492
Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: Shewmr4_0493
Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: Shewmr4_0494
Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: Shewmr4_0495
Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: Shewmr4_0496
Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: Shewmr4_0497
Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: Shewmr4_0498
Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain |
||||
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR | -253 | 6.4 | GTCTTTTTATATCTCAAAAAAC | Shewmr4_0488 |
Shewanella sp MR-7 | ||||
Position: -253
Score: 6.44938 Sequence: GTCTTTTTAGATCTCAAAAACC
Locus tag: Shewmr7_3542
Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Shewmr7_3541
Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Shewmr7_3540
Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Shewmr7_3539
Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Shewmr7_3538
Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: Shewmr7_3537
Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: Shewmr7_3536
Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: Shewmr7_3535
Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: Shewmr7_3534
Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: Shewmr7_3533
Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: Shewmr7_3532
Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain |
||||
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR | -253 | 6.4 | GTCTTTTTAGATCTCAAAAACC | Shewmr7_3542 |
Shewanella woodyi ATCC 51908 | ||||
Position: -258
Score: 5.82181 Sequence: CAGTTTTTAGATCTAAAAAATC
Position: -134
Score: 4.91542 Sequence: TGTTTTTTATATGGAAAATACT
Locus tag: Swoo_4456
Name: tsrA Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Swoo_4455
Name: tsrB Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Swoo_4454
Name: tsrC Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Swoo_4453
Name: tsrD Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Swoo_4452
Name: tsrE Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: Swoo_4451
Name: tsrF Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: Swoo_4450
Name: tsrG Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: Swoo_4449
Name: tsrH Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: Swoo_4448
Name: tsrI Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: Swoo_4447
Name: tsrY Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: Swoo_4446
Name: tsrR Funciton: Predicted transcriptional regulator, winged HTH domain |
||||
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR | -258 | 5.8 | CAGTTTTTAGATCTAAAAAATC | Swoo_4456 |
-134 | 4.9 | TGTTTTTTATATGGAAAATACT |