Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing tsrD gene

Properties
Regulog: TsrR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode:
Biological process: Thiosulfate reduction
Effector: Thiosulfate
Phylum: Proteobacteria/gamma
Built upon 40 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella halifaxensis HAW-EB4
Position: -287
Score: 4.73586
Sequence: CTTTTTTGCGATTCAAAAAACG
Position: -257
Score: 6.03197
Sequence: TGATTTTTATATCTAAAAAGAT
Locus tag: Shal_0567
Name: tsrA
Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Shal_0568
Name: tsrB
Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Shal_0569
Name: tsrC
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Shal_0570
Name: tsrD
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Shal_0571
Name: tsrE
Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: Shal_0572
Name: tsrF
Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: Shal_0573
Name: tsrG
Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: Shal_0574
Name: tsrH
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: Shal_0575
Name: tsrI
Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: Shal_0576
Name: tsrY
Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: Shal_0577
Name: tsrR
Funciton: Predicted transcriptional regulator, winged HTH domain
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR -287 4.7 CTTTTTTGCGATTCAAAAAACG Shal_0567
-257 6 TGATTTTTATATCTAAAAAGAT
Shewanella loihica PV-4
Position: -320
Score: 5.37216
Sequence: TATTTTTCATAACTCAAAAAGC
Position: -290
Score: 6.20201
Sequence: CTTTTTTGAGATCTAAAAATGC
Locus tag: Shew_0348
Name: tsrA
Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Shew_0349
Name: tsrB
Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Shew_0350
Name: tsrC
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Shew_0351
Name: tsrD
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Shew_0352
Name: tsrE
Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: Shew_0353
Name: tsrF
Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: Shew_0354
Name: tsrG
Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: Shew_0355
Name: tsrH
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: Shew_0356
Name: tsrI
Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: Shew_0357
Name: tsrY
Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: Shew_0358
Name: tsrR
Funciton: Predicted transcriptional regulator, winged HTH domain
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR -320 5.4 TATTTTTCATAACTCAAAAAGC Shew_0348
-290 6.2 CTTTTTTGAGATCTAAAAATGC
Shewanella oneidensis MR-1
Position: -250
Score: 6.87076
Sequence: GTTTTTTTAGATCTAAAAAAAC
Locus tag: SO0479
Name: tsrA
Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: SO0480
Name: tsrB
Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: SO0481
Name: tsrC
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: SO0482
Name: tsrD
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: SO0483
Name: tsrE
Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: SO0484
Name: tsrF
Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: SO0485
Name: tsrG
Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: SO0486
Name: tsrH
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: SO0487
Name: tsrI
Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: SO0488
Name: tsrY
Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: SO0490
Name: tsrR
Funciton: Predicted transcriptional regulator, winged HTH domain
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR -250 6.9 GTTTTTTTAGATCTAAAAAAAC SO0479
Shewanella pealeana ATCC 700345
Position: -264
Score: 6.31096
Sequence: GTCTTTTTAGATATCAAAAAAT
Position: -262
Score: 4.79101
Sequence: CTTTTTAGATATCAAAAAATGC
Locus tag: Spea_0479
Name: tsrA
Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Spea_0480
Name: tsrB
Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Spea_0481
Name: tsrC
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Spea_0482
Name: tsrD
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Spea_0483
Name: tsrE
Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: Spea_0484
Name: tsrF
Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: Spea_0485
Name: tsrG
Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: Spea_0486
Name: tsrH
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: Spea_0487
Name: tsrI
Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: Spea_0488
Name: tsrY
Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: Spea_0489
Name: tsrR
Funciton: Predicted transcriptional regulator, winged HTH domain
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR -264 6.3 GTCTTTTTAGATATCAAAAAAT Spea_0479
-262 4.8 CTTTTTAGATATCAAAAAATGC
Shewanella piezotolerans WP3
Position: -366
Score: 6.4489
Sequence: CTTTTTTTAGATCTAAAAATAA
Locus tag: swp_4657
Name: tsrA
Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: swp_4656
Name: tsrB
Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: swp_4655
Name: tsrC
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: swp_4654
Name: tsrD
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: swp_4653
Name: tsrE
Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: swp_4652
Name: tsrF
Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: swp_4651
Name: tsrG
Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: swp_4649
Name: tsrH
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: swp_4648
Name: tsrI
Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: swp_4647
Name: tsrY
Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: swp_4644
Name: tsrR
Funciton: Predicted transcriptional regulator, winged HTH domain
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR -366 6.4 CTTTTTTTAGATCTAAAAATAA swp_4657
Shewanella putrefaciens CN-32
Position: -253
Score: 5.77197
Sequence: TTTTTTTTATAACTAAAACAGG
Position: -232
Score: 5.98059
Sequence: GCTTTTTTACTTCTAAAAAACA
Locus tag: Sputcn32_3364
Name: tsrA
Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Sputcn32_3363
Name: tsrB
Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Sputcn32_3362
Name: tsrC
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Sputcn32_3361
Name: tsrD
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Sputcn32_3360
Name: tsrG
Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: Sputcn32_3359
Name: tsrH
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: Sputcn32_3358
Name: tsrI
Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: Sputcn32_3357
Name: tsrY
Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: Sputcn32_3356
Name: tsrR
Funciton: Predicted transcriptional regulator, winged HTH domain
tsrA-tsrB-tsrC-tsrD-tsrG-tsrH-tsrI-tsrY-tsrR -253 5.8 TTTTTTTTATAACTAAAACAGG Sputcn32_3364
-232 6 GCTTTTTTACTTCTAAAAAACA
Shewanella sediminis HAW-EB3
Position: -254
Score: 6.12805
Sequence: ATCCTTTTAGATCTAAAAAACA
Locus tag: Ssed_0482
Name: tsrA
Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Ssed_0483
Name: tsrB
Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Ssed_0484
Name: tsrC
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Ssed_0485
Name: tsrD
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Ssed_0486
Name: tsrE
Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: Ssed_0487
Name: tsrF
Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: Ssed_0488
Name: tsrG
Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: Ssed_0489
Name: tsrH
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: Ssed_0490
Name: tsrI
Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: Ssed_0491
Name: tsrY
Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: Ssed_0492
Name: tsrR
Funciton: Predicted transcriptional regulator, winged HTH domain
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR -254 6.1 ATCCTTTTAGATCTAAAAAACA Ssed_0482
Shewanella sp ANA-3
Position: -253
Score: 6.44135
Sequence: CTCTTTTTAGATCTAAAAAGCC
Locus tag: Shewana3_0489
Name: tsrA
Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Shewana3_0490
Name: tsrB
Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Shewana3_0491
Name: tsrC
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Shewana3_0492
Name: tsrD
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Shewana3_0493
Name: tsrE
Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: Shewana3_0494
Name: tsrF
Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF -253 6.4 CTCTTTTTAGATCTAAAAAGCC Shewana3_0489
Shewanella sp MR-4
Position: -253
Score: 6.4162
Sequence: GTCTTTTTATATCTCAAAAAAC
Locus tag: Shewmr4_0488
Name: tsrA
Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Shewmr4_0489
Name: tsrB
Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Shewmr4_0490
Name: tsrC
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Shewmr4_0491
Name: tsrD
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Shewmr4_0492
Name: tsrE
Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: Shewmr4_0493
Name: tsrF
Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: Shewmr4_0494
Name: tsrG
Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: Shewmr4_0495
Name: tsrH
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: Shewmr4_0496
Name: tsrI
Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: Shewmr4_0497
Name: tsrY
Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: Shewmr4_0498
Name: tsrR
Funciton: Predicted transcriptional regulator, winged HTH domain
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR -253 6.4 GTCTTTTTATATCTCAAAAAAC Shewmr4_0488
Shewanella sp MR-7
Position: -253
Score: 6.44938
Sequence: GTCTTTTTAGATCTCAAAAACC
Locus tag: Shewmr7_3542
Name: tsrA
Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Shewmr7_3541
Name: tsrB
Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Shewmr7_3540
Name: tsrC
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Shewmr7_3539
Name: tsrD
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Shewmr7_3538
Name: tsrE
Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: Shewmr7_3537
Name: tsrF
Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: Shewmr7_3536
Name: tsrG
Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: Shewmr7_3535
Name: tsrH
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: Shewmr7_3534
Name: tsrI
Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: Shewmr7_3533
Name: tsrY
Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: Shewmr7_3532
Name: tsrR
Funciton: Predicted transcriptional regulator, winged HTH domain
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR -253 6.4 GTCTTTTTAGATCTCAAAAACC Shewmr7_3542
Shewanella sp W3-18-1
Position: -253
Score: 5.77197
Sequence: TTTTTTTTATAACTAAAACAGG
Position: -232
Score: 5.98059
Sequence: GCTTTTTTACTTCTAAAAAACA
Locus tag: Sputw3181_0577
Name: tsrA
Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Sputw3181_0578
Name: tsrB
Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Sputw3181_0579
Name: tsrC
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Sputw3181_0580
Name: tsrD
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Sputw3181_0581
Name: tsrG
Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: Sputw3181_0582
Name: tsrH
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: Sputw3181_0583
Name: tsrI
Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: Sputw3181_0584
Name: tsrY
Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: Sputw3181_0585
Name: tsrR
Funciton: Predicted transcriptional regulator, winged HTH domain
tsrA-tsrB-tsrC-tsrD-tsrG-tsrH-tsrI-tsrY-tsrR -253 5.8 TTTTTTTTATAACTAAAACAGG Sputw3181_0577
-232 6 GCTTTTTTACTTCTAAAAAACA
Shewanella woodyi ATCC 51908
Position: -258
Score: 5.82181
Sequence: CAGTTTTTAGATCTAAAAAATC
Position: -134
Score: 4.91542
Sequence: TGTTTTTTATATGGAAAATACT
Locus tag: Swoo_4456
Name: tsrA
Funciton: Predicted thiosulfate respiratory reductase, cytochrome c-552/4 subunit TsrA
Locus tag: Swoo_4455
Name: tsrB
Funciton: Predicted thiosulfate respiratory reductase, rhodanese domain protein TsrB
Locus tag: Swoo_4454
Name: tsrC
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrC, peptidyl-prolyl cis-trans isomerase
Locus tag: Swoo_4453
Name: tsrD
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrD, cytochrome c-type heme lyase
Locus tag: Swoo_4452
Name: tsrE
Funciton: Predicted thiosulfate respiratory reductase, 4Fe-4S protein TsrE
Locus tag: Swoo_4451
Name: tsrF
Funciton: Predicted thiosulfate respiratory reductase, integral transmembrane protein TsrF
Locus tag: Swoo_4450
Name: tsrG
Funciton: Predicted thiosulfate respiratory reductase maturation protein, outer-membrane lipoprotein TsrG
Locus tag: Swoo_4449
Name: tsrH
Funciton: Predicted thiosulfate respiratory reductase maturation protein TsrH
Locus tag: Swoo_4448
Name: tsrI
Funciton: Predicted thiosulfate respiratory reductasematuration protein TsrI (ATPase)
Locus tag: Swoo_4447
Name: tsrY
Funciton: Predicted thiosulfate respiratory reductase maturation transmembrane protein TsrJ
Locus tag: Swoo_4446
Name: tsrR
Funciton: Predicted transcriptional regulator, winged HTH domain
tsrA-tsrB-tsrC-tsrD-tsrE-tsrF-tsrG-tsrH-tsrI-tsrY-tsrR -258 5.8 CAGTTTTTAGATCTAAAAAATC Swoo_4456
-134 4.9 TGTTTTTTATATGGAAAATACT