Orthologous regulated operons containing matB gene
Regulog: | MlnR - Alcaligenaceae |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | |
Biological process: | Malonate metabolism |
Effector: | |
Phylum: | Proteobacteria/Beta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bordetella bronchiseptica RB50 | ||||
Position: -37
Score: 6.65499 Sequence: TTATTCATAATTATGAATTA
Locus tag: BB3362
Name: mlnR Funciton: Transcriptional regulator of malonate metabolism, GntR family
Locus tag: BB3361
Name: matA Funciton: Malonyl-CoA decarboxylase
Locus tag: BB3360
Name: BB3360 Funciton: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase
Locus tag: BB3359
Name: matB Funciton: Malonyl CoA synthetase
Locus tag: BB3358
Name: null Funciton: putative exported protein
Locus tag: BB3357
Name: sodC Funciton: Superoxide dismutase [Cu-Zn] precursor (EC 1.15.1.1)
Locus tag: BB3356
Name: BAV2471 Funciton: ABC transporter substrate-binding protein
Locus tag: BB3355
Name: BAV2470 Funciton: ABC transporter, permease protein
Locus tag: BB3354
Name: BAV2469 Funciton: ABC transporter, ATP-binding protein |
||||
mlnR-matA-BB3360-matB-BB3358-sodC-BAV2471-BAV2470-BAV2469 | -37 | 6.7 | TTATTCATAATTATGAATTA | BB3362 |
Bordetella petrii DSM 12804 | ||||
Position: -43
Score: 5.4133 Sequence: TTTCCTATAATTATGAATTA
Locus tag: Bpet3277
Name: mlnR Funciton: Transcriptional regulator of malonate metabolism, GntR family
Locus tag: Bpet3276
Name: matA Funciton: Malonyl-CoA decarboxylase
Locus tag: Bpet3275
Name: BB3360 Funciton: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase
Locus tag: Bpet3274
Name: matB Funciton: Malonyl CoA synthetase
Locus tag: Bpet3273
Name: matP Funciton: TRAP-type malonate transport system, periplasmic component
Locus tag: Bpet3272
Name: matM Funciton: TRAP-type malonate transport system, small permease component
Locus tag: Bpet3271
Name: matQ Funciton: TRAP-type malonate transport system, large permease component
Locus tag: Bpet3270
Name: BAV2471 Funciton: ABC transporter substrate-binding protein
Locus tag: Bpet3269
Name: BAV2470 Funciton: ABC transporter, permease protein
Locus tag: Bpet3268
Name: BAV2469 Funciton: ABC transporter, ATP-binding protein |
||||
mlnR-matA-BB3360-matB-matP-matM-matQ-BAV2471-BAV2470-BAV2469 | -43 | 5.4 | TTTCCTATAATTATGAATTA | Bpet3277 |