Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing cbiQ gene

Properties
Regulog: CblR - Halobacteriales
Regulator type: Transcription factor
Regulator family:
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector:
Phylum: Euryarchaeota
Built upon 91 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Halobacterium salinarum R1
Position: -69
Score: 5.23546
Sequence: AATACAAATTCAGTTGTTCT
Locus tag: OE3319R
Name: cbiM
Funciton: Substrate-specific component CbiM of cobalt ECF transporter
Locus tag: OE3318R
Name: cbiN
Funciton: Additional substrate-specific component CbiN of cobalt ECF transporter
Locus tag: OE3317R
Name: cbiQ
Funciton: Transmembrane component CbiQ of energizing module of cobalt ECF transporter
Locus tag: OE3315R
Name: cbiO
Funciton: ATPase component CbiO of energizing module of cobalt ECF transporter
cbiM-cbiN-cbiQ-cbiO -69 5.2 AATACAAATTCAGTTGTTCT OE3319R
Halobacterium sp. NRC-1
Position: -69
Score: 5.23546
Sequence: AATACAAATTCAGTTGTTCT
Locus tag: VNG1635G
Name: cbiM
Funciton: Substrate-specific component CbiM of cobalt ECF transporter
Locus tag: VNG1634G
Name: cbiN
Funciton: Additional substrate-specific component CbiN of cobalt ECF transporter
Locus tag: VNG1632G
Name: cbiQ
Funciton: Transmembrane component CbiQ of energizing module of cobalt ECF transporter
Locus tag: VNG1631G
Name: cbiO
Funciton: ATPase component CbiO of energizing module of cobalt ECF transporter
cbiM-cbiN-cbiQ-cbiO -69 5.2 AATACAAATTCAGTTGTTCT VNG1635G
Haloquadratum walsbyi DSM 16790
Position: -126
Score: 5.3072
Sequence: AAAACAATTACGCTTGCTCT
Position: -60
Score: 5.53781
Sequence: AGTACAAGCAAAATTGTTTT
Locus tag: HQ1835A
Name: cbiM
Funciton: Substrate-specific component CbiM of cobalt ECF transporter
Locus tag: HQ1836A
Name: cbiN
Funciton: Additional substrate-specific component CbiN of cobalt ECF transporter
Locus tag: HQ1837A
Name: cbiQ
Funciton: Transmembrane component CbiQ of energizing module of cobalt ECF transporter
Locus tag: HQ1838A
Name: cbiO
Funciton: ATPase component CbiO of energizing module of cobalt ECF transporter
cbiM-cbiN-cbiQ-cbiO -126 5.3 AAAACAATTACGCTTGCTCT HQ1835A
-60 5.5 AGTACAAGCAAAATTGTTTT