Orthologous regulated operons containing nrdR gene

Properties
Regulog:	CblR - Halobacteriales
Regulator type:	Transcription factor
Regulator family:
Regulation mode:
Biological process:	Cobalamin biosynthesis
Effector:
Phylum:	Euryarchaeota

Built upon 91 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Halomicrobium mukohataei DSM 12286
Position: -136 Score: 4.90606 Sequence: TAATCAAGTCTAATTGTACT Locus tag: Hmuk_3351 Name: nrdR Funciton: Ribonucleotide reductase transcriptional regulator NrdR Locus tag: Hmuk_3350 Name: nrdB2 Funciton: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1) Locus tag: Hmuk_3349 Name: nrdA2 Funciton: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1)
nrdR-nrdB2-nrdA2	-136	4.9	TAATCAAGTCTAATTGTACT	Hmuk_3351
Halorhabdus utahensis DSM 12940
Position: -133 Score: 5.10158 Sequence: AGTACAACTGAACTTGGACT Locus tag: Huta_2339 Name: nrdR Funciton: Ribonucleotide reductase transcriptional regulator NrdR Locus tag: Huta_2338 Name: nrdA1 Funciton: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1) Locus tag: Huta_2337 Name: nrdB1 Funciton: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1)
nrdR-nrdA1-nrdB1	-133	5.1	AGTACAACTGAACTTGGACT	Huta_2339
Halorubrum lacusprofundi ATCC 49239
Position: -136 Score: 5.46877 Sequence: AATACAAGTTTAGTTGTGTT Locus tag: Hlac_2946 Name: nrdR Funciton: Ribonucleotide reductase transcriptional regulator NrdR Locus tag: Hlac_2945 Name: nrdB2 Funciton: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1) Locus tag: Hlac_2944 Name: nrdA2 Funciton: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1)
nrdR-nrdB2-nrdA2	-136	5.5	AATACAAGTTTAGTTGTGTT	Hlac_2946
Natrialba magadii ATCC 43099
Position: -136 Score: 3.99336 Sequence: AACACAAGTGAATTTTCACT Locus tag: Nmag_2658 Name: nrdR Funciton: Ribonucleotide reductase transcriptional regulator NrdR Locus tag: Nmag_2657 Name: nrdA1 Funciton: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1) Locus tag: Nmag_2656 Name: nrdB1 Funciton: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1)
nrdR-nrdA1-nrdB1	-136	4	AACACAAGTGAATTTTCACT	Nmag_2658
Natronomonas pharaonis DSM 2160
Position: -137 Score: 4.95164 Sequence: AAATCAAGTTCATTTGTACT Position: -117 Score: 4.259 Sequence: ACACCAATTTTATTTGGAAA Locus tag: NP6162A Name: nrdR Funciton: Ribonucleotide reductase transcriptional regulator NrdR Locus tag: NP6164A Name: null Funciton: hypothetical protein Locus tag: NP6166A Name: nrdB2 Funciton: Ribonucleotide reductase of class Ia (aerobic), beta subunit (EC 1.17.4.1) Locus tag: NP6168A Name: nrdA2 Funciton: Ribonucleotide reductase of class Ia (aerobic), alpha subunit (EC 1.17.4.1)
nrdR-NP6164A-nrdB2-nrdA2	-137	5	AAATCAAGTTCATTTGTACT	NP6162A
	-117	4.3	ACACCAATTTTATTTGGAAA