Orthologous regulated operons containing cbtB gene
Regulog: | CblR - Halobacteriales |
Regulator type: | Transcription factor |
Regulator family: | |
Regulation mode: | |
Biological process: | Cobalamin biosynthesis |
Effector: | |
Phylum: | Euryarchaeota |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Haloarcula marismortui ATCC 43049 | ||||
Position: -39
Score: 5.12809 Sequence: TTTACAATCTTACTTGTTCT
Locus tag: rrnAC3016
Name: cbtB Funciton: Cobalt transporter subunit CbtB, putative |
||||
cbtB | -39 | 5.1 | TTTACAATCTTACTTGTTCT | rrnAC3016 |
Haloferax volcanii DS2 | ||||
Position: -142
Score: 5.43003 Sequence: AAAACAATTGTGCTTGTTGT
Position: -66
Score: 5.10688 Sequence: AACACAATCTCGCTTGTTCT
Position: -39
Score: 5.04933 Sequence: TTTACAACTGTGCTTGGTTT
Locus tag: HVO_B0063
Name: cbtB Funciton: Cobalt transporter subunit CbtB, putative |
||||
cbtB | -142 | 5.4 | AAAACAATTGTGCTTGTTGT | HVO_B0063 |
-66 | 5.1 | AACACAATCTCGCTTGTTCT | ||
-39 | 5 | TTTACAACTGTGCTTGGTTT | ||
Halomicrobium mukohataei DSM 12286 | ||||
Position: -38
Score: 4.73694 Sequence: TTTACAATCTAGTTTGTACT
Locus tag: Hmuk_1861
Name: cbtB Funciton: Cobalt transporter subunit CbtB, putative |
||||
cbtB | -38 | 4.7 | TTTACAATCTAGTTTGTACT | Hmuk_1861 |
Halorubrum lacusprofundi ATCC 49239 | ||||
Position: -39
Score: 4.91175 Sequence: TTTACAAGCTCAGTTGTGTT
Locus tag: Hlac_3463
Name: cbtB Funciton: Cobalt transporter subunit CbtB, putative |
||||
cbtB | -39 | 4.9 | TTTACAAGCTCAGTTGTGTT | Hlac_3463 |
Haloterrigena turkmenica DSM 5511 | ||||
Position: -37
Score: 5.33734 Sequence: TTTACAACTATACTTGTTCT
Locus tag: Htur_5160
Name: cbtB Funciton: Cobalt transporter subunit CbtB, putative |
||||
cbtB | -37 | 5.3 | TTTACAACTATACTTGTTCT | Htur_5160 |
Natronomonas pharaonis DSM 2160 | ||||
Position: -29
Score: 4.01304 Sequence: TGATAAACTCCGGTTGTTCT
Position: -9
Score: 4.64701 Sequence: AATACAACCGTGATTGACAA
Locus tag: NP1094A
Name: chlID Funciton: ChlI component of cobalt chelatase involved in B12 biosynthesis / ChlD component of cobalt chelatase involved in B12 biosynthesis
Locus tag: NP1096A
Name: cbtB Funciton: Cobalt transporter subunit CbtB, putative
Locus tag: NP1098A
Name: cbtA Funciton: Predicted cobalt transporter CbtA
Locus tag: NP1100A
Name: cbiX_2 Funciton: conserved cobalamin cluster protein CbiX 2 (probable ferredoxin-like iron-sulfur protein) |
||||
chlID-cbtB-cbtA-cbiX_2 | -29 | 4 | TGATAAACTCCGGTTGTTCT | NP1094A |
-9 | 4.6 | AATACAACCGTGATTGACAA |