Orthologous regulated operons containing trpG gene
Regulog: | TrpR - Xanthomonadales |
Regulator type: | Transcription factor |
Regulator family: | TrpR |
Regulation mode: | repressor |
Biological process: | Tryptophan biosynthesis |
Effector: | Tryptophan |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Xylella fastidiosa 9a5c | ||||
Position: -52
Score: 5.92911 Sequence: CGTACTGATGTACCATTACA
Locus tag: XF1914
Name: trpE Funciton: Anthranilate synthase, aminase component (EC 4.1.3.27)
Locus tag: XF1915
Name: trpG Funciton: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) @ Para-aminobenzoate synthase, amidotransferase component (EC 2.6.1.85)
Locus tag: XF1916
Name: COG1541 Funciton: Coenzyme F390 synthetase
Locus tag: XF1917
Name: SSF55729 Funciton: Acyl-CoA N-acyltransferase |
||||
trpE-trpG-COG1541-SSF55729 | -52 | 5.9 | CGTACTGATGTACCATTACA | XF1914 |