Orthologous regulated operons containing CJA_0600 gene

Properties
Regulog:	CJA_0601 - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Hypothetical ABC transporter
Effector:
Phylum:	Proteobacteria/Gamma

Built upon 1 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cellvibrio japonicus Ueda107
Position: -61 Score: 6.05194 Sequence: TGTGTATTAGTGTATTGATACACG Locus tag: CJA_0598 Name: HCH_01828 Funciton: GumN family protein Locus tag: CJA_0599 Name: null Funciton: ABC transporter, ATP-binding protein Locus tag: CJA_0600 Name: CJA_0600 Funciton: putative membrane protein Locus tag: CJA_0601 Name: CJA_0601 Funciton: Transcriptional regulator, GntR family Locus tag: CJA_0602 Name: PF0561 Funciton: Hydrolase, alpha/beta hydrolase fold family Locus tag: CJA_0603 Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component Locus tag: CJA_0604 Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component
HCH_01828-CJA_0599-CJA_0600-CJA_0601-PF0561-COG4555-COG1668	-61	6.1	TGTGTATTAGTGTATTGATACACG	CJA_0598

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --