Orthologous regulated operons containing HCH_01828 gene
| Regulog: | CJA_0601 - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Hypothetical ABC transporter |
| Effector: | |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Cellvibrio japonicus Ueda107 | ||||
|
Position: -61
Score: 6.05194 Sequence: TGTGTATTAGTGTATTGATACACG
Locus tag: CJA_0598
Name: HCH_01828 Funciton: GumN family protein
Locus tag: CJA_0599
Name: null Funciton: ABC transporter, ATP-binding protein
Locus tag: CJA_0600
Name: CJA_0600 Funciton: putative membrane protein
Locus tag: CJA_0601
Name: CJA_0601 Funciton: Transcriptional regulator, GntR family
Locus tag: CJA_0602
Name: PF0561 Funciton: Hydrolase, alpha/beta hydrolase fold family
Locus tag: CJA_0603
Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component
Locus tag: CJA_0604
Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component |
||||
| HCH_01828-CJA_0599-CJA_0600-CJA_0601-PF0561-COG4555-COG1668 | -61 | 6.1 | TGTGTATTAGTGTATTGATACACG | CJA_0598 |