Orthologous regulated operons containing lin1681 gene

Properties
Regulog:	LexA - Listeriaceae
Regulator type:	Transcription factor
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Phylum:	Firmicutes

Built upon 48 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -47 Score: 4.64164 Sequence: AAAAGGGAACGTATGTTTTATGAT Locus tag: lin1681 Name: lin1681 Funciton: Conserved hypothetical protein Locus tag: lin1680 Name: tag Funciton: DNA-3-methyladenine glycosylase (EC 3.2.2.20) Locus tag: lin1679 Name: lin1679 Funciton: Putative carboxypeptidase
lin1681-tag-lin1679	-47	4.6	AAAAGGGAACGTATGTTTTATGAT	lin1681
Listeria monocytogenes EGD-e
Position: -47 Score: 4.93443 Sequence: AAAACAGAACATATGTTTTATCAT Locus tag: lmo1640 Name: lin1681 Funciton: Conserved hypothetical protein Locus tag: lmo1639 Name: tag Funciton: DNA-3-methyladenine glycosylase (EC 3.2.2.20) Locus tag: lmo1638 Name: lin1679 Funciton: Putative carboxypeptidase
lin1681-tag-lin1679	-47	4.9	AAAACAGAACATATGTTTTATCAT	lmo1640
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -47 Score: 4.72754 Sequence: AAAATAGAACGTATGTTTTATGAT Locus tag: lse_1561 Name: lin1681 Funciton: Conserved hypothetical protein Locus tag: lse_1560 Name: tag Funciton: DNA-3-methyladenine glycosylase (EC 3.2.2.20) Locus tag: lse_1559 Name: lin1679 Funciton: Putative carboxypeptidase
lin1681-tag-lin1679	-47	4.7	AAAATAGAACGTATGTTTTATGAT	lse_1561
Listeria welshimeri serovar 6b str. SLCC5334
Position: -47 Score: 5.14336 Sequence: AAAACAGAACATATGTTTTATGAT Locus tag: lwe1656 Name: lin1681 Funciton: Conserved hypothetical protein Locus tag: lwe1655 Name: tag Funciton: DNA-3-methyladenine glycosylase (EC 3.2.2.20) Locus tag: lwe1654 Name: lin1679 Funciton: Putative carboxypeptidase
lin1681-tag-lin1679	-47	5.1	AAAACAGAACATATGTTTTATGAT	lwe1656