Orthologous regulated operons containing PF07457 gene

Properties
Regulog:	LexA - Listeriaceae
Regulator type:	Transcription factor
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Phylum:	Firmicutes

Built upon 48 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -30 Score: 5.75957 Sequence: AAATAAAAACATATGTTCGGTGGT Locus tag: lin2369 Name: addB Funciton: ATP-dependent nuclease, subunit B Locus tag: lin2368 Name: addA Funciton: ATP-dependent nuclease, subunit A Locus tag: lin2367 Name: yisK Funciton: Conserved hypothetical protein Locus tag: lin2366 Name: PF07457 Funciton: Conserved hypothetical protein
addB-addA-yisK-PF07457	-30	5.8	AAATAAAAACATATGTTCGGTGGT	lin2369
Listeria monocytogenes EGD-e
Position: -30 Score: 5.75957 Sequence: AAATAAAAACATATGTTCGGTGGT Locus tag: lmo2268 Name: addB Funciton: ATP-dependent nuclease, subunit B Locus tag: lmo2267 Name: addA Funciton: ATP-dependent nuclease, subunit A Locus tag: lmo2266 Name: yisK Funciton: Conserved hypothetical protein Locus tag: lmo2265 Name: PF07457 Funciton: Conserved hypothetical protein
addB-addA-yisK-PF07457	-30	5.8	AAATAAAAACATATGTTCGGTGGT	lmo2268
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -30 Score: 5.60011 Sequence: AAATAAAAACGTATGTTCGGTGGT Locus tag: lse_2247 Name: addB Funciton: ATP-dependent nuclease, subunit B Locus tag: lse_2246 Name: addA Funciton: ATP-dependent nuclease, subunit A Locus tag: lse_2245 Name: yisK Funciton: Conserved hypothetical protein Locus tag: lse_2244 Name: PF07457 Funciton: Conserved hypothetical protein
addB-addA-yisK-PF07457	-30	5.6	AAATAAAAACGTATGTTCGGTGGT	lse_2247
Listeria welshimeri serovar 6b str. SLCC5334
Position: -30 Score: 5.75957 Sequence: AAATAAAAACATATGTTCGGTGGT Locus tag: lwe2283 Name: addB Funciton: ATP-dependent nuclease, subunit B Locus tag: lwe2282 Name: addA Funciton: ATP-dependent nuclease, subunit A Locus tag: lwe2281 Name: yisK Funciton: Conserved hypothetical protein Locus tag: lwe2280 Name: PF07457 Funciton: Conserved hypothetical protein
addB-addA-yisK-PF07457	-30	5.8	AAATAAAAACATATGTTCGGTGGT	lwe2283