Orthologous regulated operons containing yhaM gene

Properties
Regulog:	LexA - Listeriaceae
Regulator type:	Transcription factor
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Phylum:	Firmicutes

Built upon 48 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -42 Score: 5.89468 Sequence: TAATAAGAACGTATATTCGGTTTT Locus tag: lin2325 Name: yhaO Funciton: Predicted DNA double-strand break repair protein Locus tag: lin2324 Name: yhaN Funciton: Putative DNA double-strand break repair ATPase Locus tag: lin2323 Name: yhaM Funciton: Predicted 3'-5' exoribonuclease
yhaO-yhaN-yhaM	-42	5.9	TAATAAGAACGTATATTCGGTTTT	lin2325
Listeria monocytogenes EGD-e
Position: -41 Score: 5.89468 Sequence: TAATAAGAACGTATATTCGGTTTT Locus tag: lmo2222 Name: yhaO Funciton: Predicted DNA double-strand break repair protein Locus tag: lmo2221 Name: yhaN Funciton: Putative DNA double-strand break repair ATPase Locus tag: lmo2220 Name: yhaM Funciton: Predicted 3'-5' exoribonuclease
yhaO-yhaN-yhaM	-41	5.9	TAATAAGAACGTATATTCGGTTTT	lmo2222
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -44 Score: 5.89468 Sequence: TAATAAGAACGTATATTCGGTTTT Locus tag: lse_2202 Name: yhaO Funciton: Predicted DNA double-strand break repair protein Locus tag: lse_2201 Name: yhaN Funciton: Putative DNA double-strand break repair ATPase Locus tag: lse_2200 Name: yhaM Funciton: Predicted 3'-5' exoribonuclease
yhaO-yhaN-yhaM	-44	5.9	TAATAAGAACGTATATTCGGTTTT	lse_2202
Listeria welshimeri serovar 6b str. SLCC5334
Position: -39 Score: 5.89468 Sequence: TAATAAGAACGTATATTCGGTTTT Locus tag: lwe2239 Name: yhaO Funciton: Predicted DNA double-strand break repair protein Locus tag: lwe2238 Name: yhaN Funciton: Putative DNA double-strand break repair ATPase Locus tag: lwe2237 Name: yhaM Funciton: Predicted 3'-5' exoribonuclease
yhaO-yhaN-yhaM	-39	5.9	TAATAAGAACGTATATTCGGTTTT	lwe2239