Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing yhaN gene

Properties
Regulog: LexA - Listeriaceae
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Firmicutes
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -42
Score: 5.89468
Sequence: TAATAAGAACGTATATTCGGTTTT
Locus tag: lin2325
Name: yhaO
Funciton: Predicted DNA double-strand break repair protein
Locus tag: lin2324
Name: yhaN
Funciton: Putative DNA double-strand break repair ATPase
Locus tag: lin2323
Name: yhaM
Funciton: Predicted 3'-5' exoribonuclease
yhaO-yhaN-yhaM -42 5.9 TAATAAGAACGTATATTCGGTTTT lin2325
Listeria monocytogenes EGD-e
Position: -41
Score: 5.89468
Sequence: TAATAAGAACGTATATTCGGTTTT
Locus tag: lmo2222
Name: yhaO
Funciton: Predicted DNA double-strand break repair protein
Locus tag: lmo2221
Name: yhaN
Funciton: Putative DNA double-strand break repair ATPase
Locus tag: lmo2220
Name: yhaM
Funciton: Predicted 3'-5' exoribonuclease
yhaO-yhaN-yhaM -41 5.9 TAATAAGAACGTATATTCGGTTTT lmo2222
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -44
Score: 5.89468
Sequence: TAATAAGAACGTATATTCGGTTTT
Locus tag: lse_2202
Name: yhaO
Funciton: Predicted DNA double-strand break repair protein
Locus tag: lse_2201
Name: yhaN
Funciton: Putative DNA double-strand break repair ATPase
Locus tag: lse_2200
Name: yhaM
Funciton: Predicted 3'-5' exoribonuclease
yhaO-yhaN-yhaM -44 5.9 TAATAAGAACGTATATTCGGTTTT lse_2202
Listeria welshimeri serovar 6b str. SLCC5334
Position: -39
Score: 5.89468
Sequence: TAATAAGAACGTATATTCGGTTTT
Locus tag: lwe2239
Name: yhaO
Funciton: Predicted DNA double-strand break repair protein
Locus tag: lwe2238
Name: yhaN
Funciton: Putative DNA double-strand break repair ATPase
Locus tag: lwe2237
Name: yhaM
Funciton: Predicted 3'-5' exoribonuclease
yhaO-yhaN-yhaM -39 5.9 TAATAAGAACGTATATTCGGTTTT lwe2239