Orthologous regulated operons containing nrtR gene

Properties
Regulog:	NrtR - Nocardiaceae
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Actinobacteria

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhodococcus opacus B4
Position: -64 Score: 5.1891 Sequence: TTGTAGTCATATCGACTACAA Position: -30 Score: 5.25577 Sequence: TTGTAGTCACTACGACTACAA Locus tag: ROP_15920 Name: pnuC Funciton: Ribosyl nicotinamide transporter, PnuC family Locus tag: ROP_15930 Name: nadR Funciton: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22) Locus tag: ROP_15940 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
pnuC-nadR-nrtR	-64	5.2	TTGTAGTCATATCGACTACAA	ROP_15920
	-30	5.3	TTGTAGTCACTACGACTACAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --