Orthologous regulated operons containing nadA gene

Properties
Regulog:	NrtR - Frankineae/Propionibacterineae/Pseudonocardiaceae
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Actinobacteria

Built upon 6 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Frankia sp. CcI3
Position: -106 Score: 4.91899 Sequence: TTAGAGTCTCATCGACCATTC Locus tag: Francci3_3122 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-)
nadA	-106	4.9	TTAGAGTCTCATCGACCATTC	Francci3_3122
Frankia sp. EAN1pec
Position: -97 Score: 5.37492 Sequence: TTAGAGTCTGAACGACCATTA Locus tag: Franean1_1796 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-)
nadA	-97	5.4	TTAGAGTCTGAACGACCATTA	Franean1_1796

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --