Orthologous regulated operons containing omp(Scr) gene
Regulog: | ScrR - Oceanospirillales/Alteromonadales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sucrose utilization |
Effector: | Sucrose |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Saccharophagus degradans 2-40 | ||||
Position: -132
Score: 6.74212 Sequence: TATTGCAATCGGTTGCAATT
Position: -110
Score: 6.38525 Sequence: TTTTGCAATCGTTTGTAATT
Locus tag: Sde_3963
Name: omp(Scr) Funciton: Predicted sucrose-specific TonB-dependent receptor
Locus tag: Sde_3962
Name: scrK Funciton: Fructokinase (EC 2.7.1.4)
Locus tag: Sde_3961
Name: Sde_3961 Funciton: Glycosyl hydrolase family 43, five-bladed beta-propellor domain |
||||
omp(Scr)-scrK-Sde_3961 | -132 | 6.7 | TATTGCAATCGGTTGCAATT | Sde_3963 |
-110 | 6.4 | TTTTGCAATCGTTTGTAATT |