Orthologous regulated operons containing omp(Scr) gene

Properties
Regulog:	ScrR - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Phylum:	Proteobacteria/gamma

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Saccharophagus degradans 2-40
Position: -132 Score: 6.74212 Sequence: TATTGCAATCGGTTGCAATT Position: -110 Score: 6.38525 Sequence: TTTTGCAATCGTTTGTAATT Locus tag: Sde_3963 Name: omp(Scr) Funciton: Predicted sucrose-specific TonB-dependent receptor Locus tag: Sde_3962 Name: scrK Funciton: Fructokinase (EC 2.7.1.4) Locus tag: Sde_3961 Name: Sde_3961 Funciton: Glycosyl hydrolase family 43, five-bladed beta-propellor domain
omp(Scr)-scrK-Sde_3961	-132	6.7	TATTGCAATCGGTTGCAATT	Sde_3963
	-110	6.4	TTTTGCAATCGTTTGTAATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --